Review



plenticrispr v 2 vector  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc plenticrispr v 2 vector
    Plenticrispr V 2 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plenticrispr+v+2+vector/LentiCRISPR+v2+mBAX+(Plasmid+%23129577)/pmc10551903-337-7-10
    Average 94 stars, based on 1 article reviews
    plenticrispr v 2 vector - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Transfection:

    Article Title: Glutaminyl cyclase is an enzymatic modifier of the CD47- SIRPα axis and target for cancer immunotherapy
    Article Snippet: .. To generate CD47- and QPCTL-knockout A431, A375, A549, DLD1, RKO and SKBR3 cell lines, cells were transfected with pLentiCRISPR v.2 vector (Addgene 52961) encoding sgRNA targeting the QPCTL or CD47 gene. ..

    Article Title: Long-distance modulation of bystander tumor cells by CD8 + T cell-secreted IFNγ
    Article Snippet: .. Ag - CFP + IFNγR -/- cells, Ag - CFP + HLA-A -/- cells and Ag - CFP + IFNγR -/- HLA-A -/- cells were generated using the CRISPR–Cas9 system, by transfection of cells with a pLentiCRISPR v.2 vector (Addgene 52961) encoding the sgRNA sequence ACATGAACCCTATCGTATAT (IFNγR1) or GCCAGTCACAGACTGACCGAG (HLA-A) using X-tremeGENE (Roche), according to the manufacturer’s protocol. .. 48h after transfection, cells were selected with 2 mg/ml puromycin (Sigma) for one day, and cells negative for IFNγR1/HLA-A*02 were isolated on a FACSaria Fusion (BD biosciences) to >90% purity.

    Article Title: Schlafen-5 inhibits LINE-1 retrotransposition
    Article Snippet: .. Briefly, HeLa cells were transfected with the pLentiCRISPR v.2 vector (Addgene) encoding 5 independent sgRNAs targeting SLFN5 and a scramble sgRNA (negative control). ..

    Plasmid Preparation:

    Article Title: Glutaminyl cyclase is an enzymatic modifier of the CD47- SIRPα axis and target for cancer immunotherapy
    Article Snippet: .. To generate CD47- and QPCTL-knockout A431, A375, A549, DLD1, RKO and SKBR3 cell lines, cells were transfected with pLentiCRISPR v.2 vector (Addgene 52961) encoding sgRNA targeting the QPCTL or CD47 gene. ..

    Article Title: SLFN11 can sensitize tumor cells towards IFN-γ-mediated T cell killing
    Article Snippet: .. To generate bulk knockout HAP1 cells, cells were transduced with pLentiCRISPR v.2 vector (Addgene 52961) encoding two independent sgRNAs targeting SLFN11. ..

    Article Title: Disruption of the Axonal Trafficking of Tyrosine Hydroxylase mRNA Impairs Catecholamine Biosynthesis in the Axons of Sympathetic Neurons
    Article Snippet: DNA targeting was performed using two CRISPR guide RNAs (gRNAs), which bound flanking regions of the 50-bp zip-code located in the 3’UTR of the TH gene ( Fig. 1 A ). gRNAs were designed using an online CRISPR Design Tool (crispr.mit.edu), and generated by the slow annealing and phosphorylation of two complementary oligonucleotides (IDT) with T4 polynucleotide kinase (New England Biolabs) in a 10 μL reaction mixture. gRNA1 forward oligo (Fw): 5’ CACCG TTACTACTGCATGCACTCCA 3’; reverse oligo (Rv): 5’ C AATGATGACGTACGTGAGGT CAAA 3’; gRNA2 Fw oligo: 5’ CACCG CCTTTATTGAGAGAATAATC 3’; Rv oligo: 5’ AAAC GATTATTCTCTCAATAAAGG C 3’ (target sequence is underlined). .. The pLentiCRISPR v.2 vector (AddGene) was digested using BsmBI, and a 1:250 dilution of annealed oligos were cloned into the single gRNA scaffold of the linearized pLentiCRISPR vector backbone as described by ( ). .. Plasmid purification and endotoxin removal for CRISPR constructs were performed using the GenElute HP Plasmid Maxiprep kit (Sigma-Aldrich).

    Article Title: Schlafen-5 inhibits LINE-1 retrotransposition
    Article Snippet: .. Briefly, HeLa cells were transfected with the pLentiCRISPR v.2 vector (Addgene) encoding 5 independent sgRNAs targeting SLFN5 and a scramble sgRNA (negative control). ..

    Modification:

    Article Title: Combinatorial gene targeting in primary human hematopoietic stem and progenitor cells.
    Article Snippet: .. To add a second promotor to the modified version of the pLentiCRISPR v.2 vector (Addgene vector #52,961, denoted pLCv2)14, the H1 promotor16 and a second sgRNA with chRNA2 backbone was inserted after the U6-sgRNA cassette through restriction enzyme cloning. ..

    Article Title: Combinatorial gene targeting in primary human hematopoietic stem and progenitor cells
    Article Snippet: .. To add a second promotor to the modified version of the pLentiCRISPR v.2 vector (Addgene vector #52,961, denoted pLCv2) , the H1 promotor and a second sgRNA with chRNA2 backbone was inserted after the U6-sgRNA cassette through restriction enzyme cloning. ..

    Article Title: Combined lentiviral- and RNA-mediated CRISPR/Cas9 delivery for efficient and traceable gene editing in human hematopoietic stem and progenitor cells
    Article Snippet: .. sgRNA sequences (Supplementary Table ) were cloned into a modified version of the pLentiCRISPR v.2 vector (Addgene vector #52961, denoted pLCv2) following the U6 promoter, followed by the standard guide RNA backbone (chRNA1) or the modified guide RNA backbone (chRNA2), using BsmBI sites. ..

    Cloning:

    Article Title: Combinatorial gene targeting in primary human hematopoietic stem and progenitor cells.
    Article Snippet: .. To add a second promotor to the modified version of the pLentiCRISPR v.2 vector (Addgene vector #52,961, denoted pLCv2)14, the H1 promotor16 and a second sgRNA with chRNA2 backbone was inserted after the U6-sgRNA cassette through restriction enzyme cloning. ..

    Article Title: Combinatorial gene targeting in primary human hematopoietic stem and progenitor cells
    Article Snippet: .. To add a second promotor to the modified version of the pLentiCRISPR v.2 vector (Addgene vector #52,961, denoted pLCv2) , the H1 promotor and a second sgRNA with chRNA2 backbone was inserted after the U6-sgRNA cassette through restriction enzyme cloning. ..

    Generated:

    Article Title: Long-distance modulation of bystander tumor cells by CD8 + T cell-secreted IFNγ
    Article Snippet: .. Ag - CFP + IFNγR -/- cells, Ag - CFP + HLA-A -/- cells and Ag - CFP + IFNγR -/- HLA-A -/- cells were generated using the CRISPR–Cas9 system, by transfection of cells with a pLentiCRISPR v.2 vector (Addgene 52961) encoding the sgRNA sequence ACATGAACCCTATCGTATAT (IFNγR1) or GCCAGTCACAGACTGACCGAG (HLA-A) using X-tremeGENE (Roche), according to the manufacturer’s protocol. .. 48h after transfection, cells were selected with 2 mg/ml puromycin (Sigma) for one day, and cells negative for IFNγR1/HLA-A*02 were isolated on a FACSaria Fusion (BD biosciences) to >90% purity.

    CRISPR:

    Article Title: Long-distance modulation of bystander tumor cells by CD8 + T cell-secreted IFNγ
    Article Snippet: .. Ag - CFP + IFNγR -/- cells, Ag - CFP + HLA-A -/- cells and Ag - CFP + IFNγR -/- HLA-A -/- cells were generated using the CRISPR–Cas9 system, by transfection of cells with a pLentiCRISPR v.2 vector (Addgene 52961) encoding the sgRNA sequence ACATGAACCCTATCGTATAT (IFNγR1) or GCCAGTCACAGACTGACCGAG (HLA-A) using X-tremeGENE (Roche), according to the manufacturer’s protocol. .. 48h after transfection, cells were selected with 2 mg/ml puromycin (Sigma) for one day, and cells negative for IFNγR1/HLA-A*02 were isolated on a FACSaria Fusion (BD biosciences) to >90% purity.

    Sequencing:

    Article Title: Long-distance modulation of bystander tumor cells by CD8 + T cell-secreted IFNγ
    Article Snippet: .. Ag - CFP + IFNγR -/- cells, Ag - CFP + HLA-A -/- cells and Ag - CFP + IFNγR -/- HLA-A -/- cells were generated using the CRISPR–Cas9 system, by transfection of cells with a pLentiCRISPR v.2 vector (Addgene 52961) encoding the sgRNA sequence ACATGAACCCTATCGTATAT (IFNγR1) or GCCAGTCACAGACTGACCGAG (HLA-A) using X-tremeGENE (Roche), according to the manufacturer’s protocol. .. 48h after transfection, cells were selected with 2 mg/ml puromycin (Sigma) for one day, and cells negative for IFNγR1/HLA-A*02 were isolated on a FACSaria Fusion (BD biosciences) to >90% purity.

    Knock-Out:

    Article Title: SLFN11 can sensitize tumor cells towards IFN-γ-mediated T cell killing
    Article Snippet: .. To generate bulk knockout HAP1 cells, cells were transduced with pLentiCRISPR v.2 vector (Addgene 52961) encoding two independent sgRNAs targeting SLFN11. ..

    Transduction:

    Article Title: SLFN11 can sensitize tumor cells towards IFN-γ-mediated T cell killing
    Article Snippet: .. To generate bulk knockout HAP1 cells, cells were transduced with pLentiCRISPR v.2 vector (Addgene 52961) encoding two independent sgRNAs targeting SLFN11. ..

    Clone Assay:

    Article Title: Combined lentiviral- and RNA-mediated CRISPR/Cas9 delivery for efficient and traceable gene editing in human hematopoietic stem and progenitor cells
    Article Snippet: .. sgRNA sequences (Supplementary Table ) were cloned into a modified version of the pLentiCRISPR v.2 vector (Addgene vector #52961, denoted pLCv2) following the U6 promoter, followed by the standard guide RNA backbone (chRNA1) or the modified guide RNA backbone (chRNA2), using BsmBI sites. ..

    Article Title: Disruption of the Axonal Trafficking of Tyrosine Hydroxylase mRNA Impairs Catecholamine Biosynthesis in the Axons of Sympathetic Neurons
    Article Snippet: DNA targeting was performed using two CRISPR guide RNAs (gRNAs), which bound flanking regions of the 50-bp zip-code located in the 3’UTR of the TH gene ( Fig. 1 A ). gRNAs were designed using an online CRISPR Design Tool (crispr.mit.edu), and generated by the slow annealing and phosphorylation of two complementary oligonucleotides (IDT) with T4 polynucleotide kinase (New England Biolabs) in a 10 μL reaction mixture. gRNA1 forward oligo (Fw): 5’ CACCG TTACTACTGCATGCACTCCA 3’; reverse oligo (Rv): 5’ C AATGATGACGTACGTGAGGT CAAA 3’; gRNA2 Fw oligo: 5’ CACCG CCTTTATTGAGAGAATAATC 3’; Rv oligo: 5’ AAAC GATTATTCTCTCAATAAAGG C 3’ (target sequence is underlined). .. The pLentiCRISPR v.2 vector (AddGene) was digested using BsmBI, and a 1:250 dilution of annealed oligos were cloned into the single gRNA scaffold of the linearized pLentiCRISPR vector backbone as described by ( ). .. Plasmid purification and endotoxin removal for CRISPR constructs were performed using the GenElute HP Plasmid Maxiprep kit (Sigma-Aldrich).

    Negative Control:

    Article Title: Schlafen-5 inhibits LINE-1 retrotransposition
    Article Snippet: .. Briefly, HeLa cells were transfected with the pLentiCRISPR v.2 vector (Addgene) encoding 5 independent sgRNAs targeting SLFN5 and a scramble sgRNA (negative control). ..



    Similar Products

    plenticrispr v 2 vector  (Addgene inc)
    94
    Addgene inc plenticrispr v 2 vector
    Plenticrispr V 2 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plenticrispr+v+2+vector/LentiCRISPR+v2+mBAX+(Plasmid+%23129577)/pmc10551903-337-7-10
    Average 94 stars, based on 1 article reviews
    plenticrispr v 2 vector - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier

    Image Search Results